Review



sc 29338 grp94 sirna santa cruz biotech  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Santa Cruz Biotechnology sc 29338 grp94 sirna santa cruz biotech
    Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, <t>GRP94,</t> HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.
    Sc 29338 Grp94 Sirna Santa Cruz Biotech, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/GRP+94+siRNA/pm36471805-196-129-132
    Average 93 stars, based on 7 article reviews
    sc 29338 grp94 sirna santa cruz biotech - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1."

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

    Journal: iScience

    doi: 10.1016/j.isci.2022.105626

    Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.
    Figure Legend Snippet: Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.

    Techniques Used: Transfection, Control, Western Blot, Plasmid Preparation, Two Tailed Test

    Related Articles

    Transfection:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Control:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Western Blot:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Plasmid Preparation:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Two Tailed Test:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Virus:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Recombinant:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Ubiquitin Proteomics:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Extraction:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    SYBR Green Assay:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Isolation:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Software:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Inhibition:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Incubation:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Staining:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Mass Spectrometry:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Labeling:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Blocking Assay:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Fluorescence:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Quantitative RT-PCR:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Activity Assay:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    SDS Page:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Knockdown:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Expressing:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Activation Assay:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Over Expression:

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.



    Similar Products

    90
    Thermo Fisher grp94 sirna
    Grp94 Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/grp94+sirna/pm38637533-300-0-5
    Average 90 stars, based on 1 article reviews
    grp94 sirna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc anti grp94
    Anti Grp94, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/SignalSilence+SP1+siRNA+I/pm37442985-112-22-24
    Average 93 stars, based on 1 article reviews
    anti grp94 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology sc 29338 grp94 sirna santa cruz biotech
    Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, <t>GRP94,</t> HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.
    Sc 29338 Grp94 Sirna Santa Cruz Biotech, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/GRP+94+siRNA/pm36471805-196-129-132
    Average 93 stars, based on 1 article reviews
    sc 29338 grp94 sirna santa cruz biotech - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology grp94 sirna
    Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, <t>GRP94,</t> HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also <xref ref-type=Figures S7 and . " width="250" height="auto" />
    Grp94 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/GRP+94+siRNA/pmc09719099-94-0-3
    Average 93 stars, based on 1 article reviews
    grp94 sirna - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Ribobio co sirnas targeting grp78, grp94, perk, eif2αand atf4
    Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, <t>GRP94,</t> HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also <xref ref-type=Figures S7 and . " width="250" height="auto" />
    Sirnas Targeting Grp78, Grp94, Perk, Eif2αand Atf4, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/grp78+sirna/pm35594636-77-7-13
    Average 90 stars, based on 1 article reviews
    sirnas targeting grp78, grp94, perk, eif2αand atf4 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology cells with endoplasmin grp94 sirna
    Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, <t>GRP94,</t> HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also <xref ref-type=Figures S7 and . " width="250" height="auto" />
    Cells With Endoplasmin Grp94 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grp94+sirna/Fluorescein/us11078260-1116-3-14
    Average 96 stars, based on 1 article reviews
    cells with endoplasmin grp94 sirna - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.

    Journal: iScience

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

    doi: 10.1016/j.isci.2022.105626

    Figure Lengend Snippet: Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.

    Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

    Techniques: Transfection, Control, Western Blot, Plasmid Preparation, Two Tailed Test

    Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also <xref ref-type=Figures S7 and . " width="100%" height="100%">

    Journal: iScience

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1

    doi: 10.1016/j.isci.2022.105626

    Figure Lengend Snippet: Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also Figures S7 and .

    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Techniques: Transfection, Control, Western Blot, Plasmid Preparation, Two Tailed Test

    Journal: iScience

    Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1

    doi: 10.1016/j.isci.2022.105626

    Figure Lengend Snippet:

    Article Snippet: GRP94 siRNA , Santa Cruz Biotech , Cat# sc-35523.

    Techniques: Virus, Recombinant, Ubiquitin Proteomics, Extraction, SYBR Green Assay, Isolation, Control, Plasmid Preparation, Software